bio-clip-seq-ago-clip-mirna-targets

SkillAI & models

Identify direct miRNA-target interactions from AGO HITS-CLIP, AGO-CLEAR-CLIP (chimeric reads), HEAP (Halo-Ago2 mouse), chimeric eCLIP / miR-eCLIP (deep miRNA-target profiling), or CLASH using chimeric-read processing pipelines, seed-pairing analysis, and 3' auxiliary pairing rules. Use when distinguishing direct miRNA targets from indirect, integrating CLIP-derived target maps with TargetScan / miRDB / DIANA predictions, applying canonical 7mer-8mer seed matching with 3' UTR context, or recovering miRNA-mRNA chimeras at scale.

Available today. Use it from your connected AI after setup.

Connect ahel once, and every AI you use reads what you have installed.

Then ask your AI: use the bio-clip-seq-ago-clip-mirna-targets skill

What this skill tells your AI

The instructions your AI receives, as published by pku-yuangroup/openai4s in skills/bioskills/bio-clip-seq-ago-clip-mirna-targets/SKILL.md and read by ahel’s review.

Version Compatibility

Reference examples tested with: eCLIP pipeline (Yeo lab), chimeric eCLIP analysis scripts (Yeo lab), HEAP pipeline (Li 2020), Hyb pipeline (Travis 2014), TargetScanHuman 8.0, miRDB 6.0, samtools 1.19+, bedtools 2.31+, pyHyb 0.4+.

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures
  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws unexpected errors, introspect the installed package and adapt the example to match the actual API rather than retrying.

AGO-CLIP and miRNA Target Identification

"Identify direct miRNA-target interactions experimentally" -> Use Argonaute (AGO1-4) CLIP-seq variants to map miRNA-binding sites on mRNAs, then resolve which miRNA pairs with each site. Three approaches: (a) standard AGO-CLIP recovers AGO-bound sites but cannot say which miRNA; (b) chimeric methods (CLEAR-CLIP, chimeric eCLIP / miR-eCLIP) ligate the miRNA to its target during library prep, producing miRNA-mRNA chimeric reads that unambiguously assign miRNA-target pairs; (c) HEAP uses HaloTag-Ago2 for in vivo profiling. The chimeric methods are the gold standard for direct miRNA-target identification; standard AGO-CLIP must be combined with computational seed-matching (TargetScan, miRDB) to infer miRNA pairing. Resolution: chimeric reads pinpoint single miRNA-target pairs; AGO-only CLIP identifies "AGO-binding sites" of which a subset are miRNA targets.

  • CLI (chimeric eCLIP / miR-eCLIP processing): custom pipeline starting from eCLIP-style preprocessing + chimeric-read identification + miRNA-mRNA junction extraction
  • CLI (CLEAR-CLIP custom Moore 2015 pipeline): Hyb (Travis 2014) for chimera analysis
  • CLI (Hyb pipeline): hyb run_hyb peaks.bam mature_miRNA.fa human.tab.gz to find miRNA-mRNA chimeras
  • CLI (HEAP analysis): standard HITS-CLIP processing pipeline + Halo-Ago2 capture details
  • Python (seed-pairing analysis on AGO CLIP peaks): scan peaks for canonical 7mer-m8, 7mer-1A, 8mer, 6mer seeds + 3' UTR position + miRNA expression filter

The Yeo lab miR-eCLIP / chimeric eCLIP is the modern depth-improved version of chimeric AGO-CLIP, enriching for chimeras of specific miRNAs of interest via PCR or on-bead probe capture. For comprehensive miRNA-target mapping, miR-eCLIP combined with eCLIP-seq-style normalization is the state-of-the-art.

Methods Taxonomy

MethodYearmiRNA-target pairingChimera enrichmentStrengthFails when
HITS-CLIP for AGO2009 (Chi)Indirect (computational seed)NoneOriginal; widely citedCannot assign miRNA without computational prediction
PAR-CLIP for AGO2010 (Hafner)IndirectNoneT->C signature at CL positionRestricted to 4SU-permissive cells
AGO-CLEAR-CLIP (Moore 2015)2015Direct (chimera)None (incidental)First direct miRNA-target chimera methodChimeric reads only 1-5% of library; deep sequencing needed
CLASH (Helwak 2013)2013Direct (chimera)NoneFirst general chimera method; pan-ArgonauteLower chimera rate than CLEAR-CLIP
HEAP (Li 2020)2020Indirect (with chimeric step)NoneHaloTag-Ago2 in vivo mouse strainMouse only; requires transgenic model
chimeric eCLIP / miR-eCLIP2022Direct (chimera)Probe/PCR enrichedDeepest miRNA-target chimera profilingSpecialized library prep
AGO-IP-microarray (Karginov 2007)2007IndirectNoneEarliest; predecessor of CLIP for AGONo crosslinking; misses transient targets

Methodology evolves; verify the current chimeric eCLIP / miR-eCLIP literature for best practice. As of 2024, miR-eCLIP is the canonical approach for deep miRNA-target profiling.

Critical Choice: Chimeric vs Computational miRNA-Target Pairing

Two fundamentally different strategies:

Chimeric methods (CLEAR-CLIP, chimeric eCLIP / miR-eCLIP, CLASH): During library prep, a ligation step covalently joins the miRNA to its target mRNA, producing chimeric reads (miRNA at 5' + target mRNA at 3'). The miRNA-target pair is read directly from the sequence. Pro: direct evidence of binding interaction; no inference. Con: chimera rate is 1-5% of library by default (substantially enriched with miR-eCLIP probe capture for specific miRNAs); deep sequencing or enrichment needed.

Computational pairing (HITS-CLIP / PAR-CLIP + seed-matching): Standard AGO CLIP identifies AGO-bound peaks; downstream computational scanning matches each peak against canonical miRNA seeds (7mer-m8, 7mer-1A, 8mer) from TargetScan, miRDB, or DIANA databases. Pro: any AGO CLIP data can be analyzed; no special library prep. Con: indirect; assigns miRNAs based on canonical seed rules, missing non-canonical interactions (3' compensatory, central pairing).

The CLEAR-CLIP analysis (Darnell lab, Moore 2015) revealed substantial 3' auxiliary pairing beyond canonical seeds: many miRNA-target interactions have weak or non-canonical seed matching but strong 3' supplementary pairing. Chimeric methods recover these; computational seed-only inference misses them.

GoalMethod
Direct miRNA-target pair identificationChimeric eCLIP / miR-eCLIP
Specific miRNA's targets (deep)miR-eCLIP with probe-capture enrichment
All AGO-binding sites (any miRNA)Standard AGO eCLIP / HITS-CLIP
In vivo mouse tissueHEAP (Halo-Ago2 mouse)
Pan-Argonaute interactomeCLASH or chimeric eCLIP
Initial discovery / cost-consciousAGO HITS-CLIP + TargetScan
Non-canonical / 3'-compensatory miRNA pairingChimeric methods (CLEAR-CLIP)
Comparison across speciesTargetScan + AGO HITS-CLIP (computational)
Validate specific miRNA-target predictionmiR-eCLIP with that miRNA's probe

miRNA-Target Pairing Rules

Computational seed-matching against TargetScan / miRDB requires understanding the canonical miRNA-target pairing rules:

Seed typePairing positions (miRNA nt)Position 1Pro / Con
8mer2-7 + position 8 + A at position 1A requiredStrongest; most conserved targets
7mer-m82-7 + position 8 (no A1 requirement)AnyStrong; common
7mer-A12-7 (no position 8) + A at position 1A requiredModerate; common
6mer2-7AnyWeak; very common (many false positives)
6mer-A12-6 + A at position 1A requiredWeak
3'-compensatoryWeak 6mer + strong 3' UTR pairing 12-17AnyDiscovered via CLEAR-CLIP; misses in seed-only methods
Central pairingPositions 4-15 with no seedAnyRare; cleavage rather than translational repression

For TargetScan integration: download the TargetScanHuman 8.0 conserved-site predictions; filter for 7mer-8mer (drop 6mer if too noisy); cross-reference with the CLIP peak BED of the analysis.

Chimeric eCLIP / miR-eCLIP Workflow

Goal: Recover miRNA-mRNA chimeras from AGO chimeric eCLIP / miR-eCLIP libraries and produce a per-miRNA target list suitable for direct biological interpretation.

Approach: Apply eCLIP-style preprocessing, then run Hyb in chimera (type=mim) mode with bowtie2 alignment (required for short 21-23 nt miRNA sequences), filter chimeras to human mRNA targets, intersect with miRNA-expression atlas (filter > 100 TPM in matched cell type), and validate top targets against TargetScan conserved 7mer-m8 / 8mer predictions.

# Step 1: eCLIP-style preprocessing (see clip-seq/clip-preprocessing)
umi_tools extract --bc-pattern=NNNNNNNNNN \
    --stdin=R1.fq.gz --read2-in=R2.fq.gz \
    --stdout=R1.umi.fq.gz --read2-out=R2.umi.fq.gz

cutadapt -a AGATCGGAAGAGCACACGTCT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    -q 6 -m 18 -o R1.trim.fq.gz -p R2.trim.fq.gz \
    R1.umi.fq.gz R2.umi.fq.gz

# Step 2: Chimera-specific alignment
# Chimeric reads have miRNA sequence (21-23 nt) at 5' followed by target mRNA
# Step 2a: Trim 5' for miRNA portion + align miRNA part
# Step 2b: Trim 3' for target mRNA portion + align target part
# Use custom chimeric-eCLIP pipeline OR Hyb (Travis 2014)

# Hyb pipeline approach (CLEAR-CLIP and chimeric methods)
hyb \
    in=R1.trim.fq.gz \
    db=miRNA_and_human_mRNA.fa \
    align=blastall \
    type=mim   # multimer (miRNA-target) chimera mode

# Output: .blast and .hyb files with miRNA-mRNA chimera coordinates

# Step 3: Filter chimeras by miRNA + target alignment quality
# Hyb reports each chimera as: miRNA_id  target_id  miRNA_alignment  target_alignment
# Filter for:
#   - miRNA portion 18-25 nt
#   - Target portion 18-50 nt
#   - miRNA-target seed match (7mer-m8 / 7mer-A1 / 8mer)
#   - Target alignment unique
awk '$5 == "human_mRNA"' chimeras.hyb > chimeras_human_mRNA.tsv

# Step 4: Aggregate chimeras into per-miRNA target list
# Each miRNA -> targets (with read counts as binding affinity proxy)
awk '{print $3, $4}' chimeras_human_mRNA.tsv | sort | uniq -c | sort -rn > mirna_target_counts.tsv

CLEAR-CLIP (Moore 2015) Analysis

CLEAR-CLIP was the first method to recover ~130k miRNA-target chimeras from mouse brain (Moore 2015). The analytical insight: AGO-CLIP reads ligated together during library prep produce chimeric reads at low rates that contain unambiguous miRNA-target pairs.

# CLEAR-CLIP analysis uses the Hyb pipeline (Travis 2014)
# Pre-requisite: AGO HITS-CLIP / PAR-CLIP BAM

# Extract candidate chimeric reads (reads that don't fully align to human mRNA)
samtools view -h dedup.bam | awk '$6 ~ /S/' | wc -l   # soft-clipped reads candidate chimeras

# Run Hyb in chimera mode
hyb \
    in=R1.trim.fq.gz \
    db=mature_miRNA_plus_human_mRNA.fa \
    align=blastall \
    type=mim

# Filter for canonical seed match
python analyze_chimeras.py \
    --chimeras chimeras.hyb \
    --mirna_db mature_human_miRNA.fa \
    --seed_types 7mer-m8 7mer-A1 8mer \
    --output validated_chimeras.tsv

miR-eCLIP Probe Enrichment

To recover deep coverage of one or a few miRNAs' targets, miR-eCLIP uses probe-based or PCR-based enrichment to amplify chimeras containing specific miRNAs.

# After chimera identification, filter for specific miRNA
# Example: enrich for hsa-miR-21 targets
grep "hsa-miR-21" chimeras_human_mRNA.tsv > mir21_targets.tsv

# Count unique target sites per miRNA
awk '{print $3}' mir21_targets.tsv | sort -u | wc -l

# Cross-reference with TargetScan conserved predictions for validation
bedtools intersect -wa -wb \
    -a mir21_targets_3utr_coords.bed \
    -b targetscan_mir21_conserved_targets.bed > mir21_validated_targets.bed

Per-Method Failure Modes

Standard AGO-CLIP -- Cannot assign miRNA

Trigger: Standard AGO eCLIP / HITS-CLIP run; user wants per-miRNA target list.

Mechanism: Standard AGO-CLIP enriches for AGO-bound RNAs but does not retain miRNA identity. Computational seed-matching infers which miRNAs are likely bound but each peak gets matched to dozens of candidate miRNAs.

Symptom: Peak BED has 100k peaks; seed-matching assigns 10-50 candidate miRNAs per peak.

Fix: Switch to chimeric method for direct pairing, OR filter computational predictions by miRNA expression in the same cell type (only consider miRNAs > 100 TPM in matched small-RNA-seq).

Chimeric methods -- Low chimera rate

Trigger: Standard chimeric eCLIP without probe enrichment; expecting deep per-miRNA targets.

Mechanism: Chimeras are 1-5% of total reads in standard chimeric eCLIP. For a 30M-read library, only 300k-1.5M chimeras; distributed across 200+ miRNAs gives only ~5000-15000 per miRNA.

Symptom: Per-miRNA target count is sparse; rare miRNAs have < 100 chimeras.

Fix: Use miR-eCLIP with probe enrichment for specific miRNAs of interest (substantial boost). Or sequence ultra-deep (200M+ reads) for global chimera profiling.

Hyb -- BLAST sensitivity vs miRNA length

Trigger: miRNA sequences (21-23 nt) too short for BLAST default sensitivity.

Mechanism: BLAST defaults need >= 100 nt for reliable alignment. miRNA 21-23 nt hits below threshold; many true chimeras lost.

Symptom: Hyb returns few chimeras; rerun with align=bowtie2 gives more.

Fix: Use bowtie2 mode for miRNA alignment (hyb align=bowtie2 type=mim); short-read aligners are designed for short sequences.

Computational seed matching -- High false positive

Trigger: TargetScan predictions used as ground truth without CLIP validation.

Mechanism: TargetScan reports all potential 7mer-m8 / 8mer matches in 3' UTRs; many sites are not functional miRNA targets (no AGO binding observed).

Symptom: TargetScan predicts thousands of targets per miRNA; only a fraction are validated by CLIP.

Fix: Use CLIP overlap as the validation: TargetScan prediction AND AGO-CLIP peak = high-confidence target. Sites in TargetScan but not in CLIP = unfunctional predictions.

Non-canonical miRNA-target pairing missed

Trigger: Seed-matching only; 3' compensatory pairing missed.

Mechanism: A substantial fraction of miRNA-target interactions have weak seeds but strong 3' UTR pairing (positions 12-17). Seed-only matching loses these.

Symptom: Chimeric methods find targets that TargetScan misses; these have weak seeds.

Fix: Accept chimeric method's targets even with weak seeds (the chimera IS the evidence). Or use TargetScan + RNAhybrid (full miRNA-target duplex prediction) for non-canonical sites.

HEAP -- Mouse-only

Trigger: Want HEAP-style in vivo AGO profiling in human tissue.

Mechanism: HEAP uses a transgenic mouse with Halo-Ago2 allele; not available in human or other species.

Symptom: Cannot replicate HEAP results in human.

Fix: Use eCLIP / chimeric eCLIP on human samples; HEAP is specifically for mouse tissue studies.

miRNA expression filter forgotten

Trigger: Computational miRNA-target assignment without filtering by miRNA expression.

Mechanism: Many miRNA databases include rare or developmental-specific miRNAs. If the miRNA is not expressed in the cell type, it cannot bind anything.

Symptom: Per-miRNA target lists include miRNAs at < 1 TPM expression - implausible binding.

Fix: Cross-reference with matched small-RNA-seq from the same cell type; filter for miRNAs > 100 TPM. ENCODE-validated cell types have published miRNA atlases.

Decision Tree by Use Case

ScenarioMethodWhy
Direct miRNA-target identification, modernchimeric eCLIP / miR-eCLIPDirect chimeras; deep enrichment available
Specific miRNA's deep target listmiR-eCLIP with probe for that miRNAprobe-based enrichment
Discover novel miRNA-target interactionsCLEAR-CLIP or chimeric eCLIPDirect chimera, no seed prior
In vivo mouse tissueHEAP (Halo-Ago2 mouse)Mouse only
Initial AGO-binding site discoveryAGO HITS-CLIP / eCLIPCost-effective; no chimera
Compare miRNA targets across speciesTargetScan + AGO HITS-CLIP each speciesComputational + experimental
3' compensatory / non-canonicalCLEAR-CLIP / chimeric eCLIPDirect chimera captures non-canonical
miRNA-perturbation effectsKD/KO + AGO-CLIP + differentialSee clip-seq/differential-clip
Cross-tissue miRNA profilingAGO eCLIP each tissueTissue-specific cell-type
Validate single miRNA predictionmiR-eCLIP with that miRNA's probeDirect experimental confirmation

Reconciliation: AGO-CLIP vs TargetScan vs Chimeric

PatternLikely causeAction
Chimera method finds targets TargetScan does notNon-canonical / 3'-compensatory pairingTrust chimera; novel target
TargetScan predicts; AGO eCLIP peak present; no chimeraFunctional target without chimera in libraryLikely real target; chimera capture stochastic
TargetScan predicts; no AGO eCLIP peakComputational false positiveNot a functional target
AGO eCLIP peak; no TargetScan matchNon-canonical or rare miRNA seedInvestigate; may be 3' compensatory
Per-miRNA target counts vary 100x across miRNAsmiRNA expression variesFilter by matched small-RNA-seq
Hyb chimeras 1% of libraryStandard rateEnrich with miR-eCLIP if needed
Different chimera tools give different countsAlgorithm sensitivity differsHyb is the most-cited; use it for canonical
HEAP and eCLIP discordantMouse vs human; in vivo vs cell lineBoth correct in their context
miR-eCLIP enriched chimera count not 30x baselineProbe inefficientVerify probe design; use multiple probes per miRNA

Operational rule: For publication-grade miRNA-target list: (a) chimeric eCLIP / miR-eCLIP for direct pairing; (b) cross-reference with TargetScan conserved predictions; (c) filter by miRNA expression > 100 TPM in matched small-RNA-seq; (d) validate top targets with reporter assay (luciferase / GFP fusion with target 3' UTR).

Common Errors

Error / symptomCauseSolution
Hyb returns few chimerasBLAST too stringent for short miRNAsUse bowtie2 mode (hyb align=bowtie2)
Per-miRNA target list sparseLow chimera rate without enrichmentUse miR-eCLIP probe enrichment
TargetScan predicts thousands per miRNANo CLIP filterRequire CLIP peak overlap for high-confidence
miRNA assignments dominate by unexpressed miRNAsNo expression filterFilter by matched small-RNA-seq > 100 TPM
Non-canonical sites missedSeed-only matchingUse chimeric methods; or RNAhybrid full duplex
HEAP results don't replicate in humanMouse-specific transgenicUse eCLIP / chimeric eCLIP in human
6mer matches dominate target listMost weak seedsRestrict to 7mer-m8 / 8mer; report 6mer separately
miRNA target chimeras unstrand-resolvedStrand information lostCheck BED column 6 throughout pipeline
Cross-tissue comparison naiveTissue-specific miRNA expressionMatch tissue-specific miRNA atlases
miR-eCLIP enrichment failsProbe non-specific or low-affinityDesign multiple probes per miRNA; validate enrichment

References

  • Chi SW et al 2009 Nature 460:479 (AGO HITS-CLIP)
  • Hafner M et al 2010 Cell 141:129 (PAR-CLIP for AGO)
  • Helwak A et al 2013 Cell 153:654 (CLASH; chimera method)
  • Travis AJ et al 2014 Methods 65:263 (Hyb pipeline)
  • Moore MJ et al 2015 Nat Commun 6:8864 (CLEAR-CLIP, 130k chimeras mouse brain)
  • Li X et al 2020 Mol Cell 79:167 (HEAP, Halo-Ago2 in vivo mouse)
  • Agarwal V et al 2015 eLife 4:e05005 (TargetScan 7.0)
  • Lewis BP et al 2003 Cell 115:787 (original 7mer/8mer seed rules)
  • Bartel DP 2018 Cell 173:20 (miRNA target principles)
  • McGeary SE et al 2019 Science 366:eaav1741 (TargetScan 8.0 / quantitative target prediction).

Related Skills

  • clip-seq/clip-peak-calling - AGO CLIP peak calls
  • clip-seq/binding-site-annotation - 3' UTR annotation
  • clip-seq/clip-motif-analysis - Seed motif scan
  • clip-seq/differential-clip - miRNA perturbation experiments
  • clip-seq/m6a-clip - DART-seq uses similar APOBEC1 fusion
  • small-rna-seq/target-prediction - TargetScan / miRDB / DIANA
  • small-rna-seq/differential-mirna - miRNA expression
  • small-rna-seq/mirdeep2-analysis - miRNA discovery

Signals

GitHub stars
404
Forks
48
Last commit
Sep 2026
Advanced
Catalog kind
skill
Gateway key
bio-clip-seq-ago-clip-mirna-targets-pku-yuangroup
Source
github.com/pku-yuangroup/openai4s